Goat Anti Cacng2 Antibody

Lab Reagents

Goat Antibody Laboratories manufactures the goat anti cacng2 antibody reagents distributed by Genprice. The Goat Anti Cacng2 Antibody reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact goat Antibody. Other Goat products are available in stock. Specificity: Goat Category: Anti Group: Cacng2 Antibody

Cacng2 Antibody information

CACNG2 antibody

70R-15058 100 ul
EUR 392
Description: Rabbit polyclonal CACNG2 antibody

CACNG2 antibody

38990-100ul 100ul
EUR 252

CACNG2 Antibody

1-CSB-PA080193
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: PBS, pH 7.4, containing 0.02% sodium azide as Preservative and 50% Glycerol. Affinity purification
Description: A polyclonal antibody against CACNG2. Recognizes CACNG2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC;WB:1:1000-2000.IHC:1:200-500

Cacng2/ Rat Cacng2 ELISA Kit

ELI-50907r 96 Tests
EUR 886

CACNG2 Conjugated Antibody

C38990 100ul
EUR 397

CACNG2 Polyclonal Antibody

ABP57222-003ml 0.03ml
EUR 158
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG2 from Human, Mouse, Rat. This CACNG2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG2 Polyclonal Antibody

ABP57222-01ml 0.1ml
EUR 289
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG2 from Human, Mouse, Rat. This CACNG2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG2 Polyclonal Antibody

ABP57222-02ml 0.2ml
EUR 414
  • Immunogen information: Synthetic Peptide
  • Applications tips:
Description: A polyclonal antibody for detection of CACNG2 from Human, Mouse, Rat. This CACNG2 antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthetic peptide

CACNG2 Polyclonal Antibody

ES8221-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CACNG2 Polyclonal Antibody

ES8221-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against CACNG2 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

CACNG2 siRNA

20-abx910095
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CACNG2 siRNA

20-abx910096
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CACNG2 Rabbit pAb

A14101-100ul 100 ul
EUR 308

CACNG2 Rabbit pAb

A14101-200ul 200 ul
EUR 459

CACNG2 Rabbit pAb

A14101-20ul 20 ul
EUR 183

CACNG2 Rabbit pAb

A14101-50ul 50 ul
EUR 223

CACNG2 cloning plasmid

CSB-CL896926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 972
  • Sequence: atggggctgtttgatcgaggtgttcaaatgcttttaaccaccgttggtgctttcgctgccttcagcctgatgaccatagctgtgggaaccgactattggctctactccagaggggtttgcaagaccaaaagtgtcagtgagaatgaaaccagcaaaaagaacgaggaagttatgac
  • Show more
Description: A cloning plasmid for the CACNG2 gene.